Published online August 9, 2005
Nucleic Acids Research, 2005, Vol. 33, No. 14 e127
doi:10.1093/nar/gni120
Headloop suppression PCR and its application to
selective amplification of methylated DNA sequences
Keith N. Rand, Thu Ho, Wenjia Qu1, Susan M. Mitchell, Rose White, Susan J. Clark1 and
Peter L. Molloy*
CSIRO Molecular and Health Technologies, PO Box 184, North Ryde NSW 1670, Australia and 1The Garvan Institute
for Medical Research, 384 Victoria Street, Darlinghurst NSW 2010, Australia
Received May 19, 2005; Revised July 12, 2005; Accepted July 14, 2005
ABSTRACT
INTRODUCTION
Specificity in PCR amplification of DNA is principally
determined by the sequence of the primers in combination
with the temperature at which the annealing step is conducted.
For closely related sequences, additional approaches targeted
to sequences between the primers have been incorporated to
*To whom correspondence should be addressed. Tel: +61 2 9490 5168; Fax: +61 2 9490 5010; Email: peter.molloy@csiro.au
The Author 2005. Published by Oxford University Press. All rights reserved.
The online version of this article has been published under an open access model. Users are entitled to use, reproduce, disseminate, or display the open access
version of this article for non-commercial purposes provided that: the original authorship is properly and fully attributed; the Journal and Oxford University Press
are attributed as the original place of publication with the correct citation details given; if an article is subsequently reproduced or disseminated not in its entirety but
only in part or as a derivative work this must be clearly indicated. For commercial re-use, please contact journals.permissions@oupjournals.org
Downloaded from http://nar.oxfordjournals.org/ by guest on September 6, 2014
Selective amplification in PCR is principally determined by the sequence of the primers and the temperature of the annealing step. We have developed a
new PCR technique for distinguishing related
sequences in which additional selectivity is dependent on sequences within the amplicon. A 50 extension
is included in one (or both) primer(s) that corresponds
to sequences within one of the related amplicons.
After copying and incorporation into the PCR product
this sequence is then able to loop back, anneal to
the internal sequences and prime to form a hairpin
structure—this structure is then refractory to further
amplification. Thus, amplification of sequences containing a perfect match to the 50 extension is
suppressed while amplification of sequences containing mismatches or lacking the sequence is unaffected. We have applied Headloop PCR to DNA that
had been bisulphite-treated for the selective amplification of methylated sequences of the human
GSTP1 gene in the presence of up to a 105-fold excess
of unmethylated sequences. Headloop PCR has a
potential for clinical application in the detection of
differently methylated DNAs following bisulphite
treatment as well as for selective amplification of
sequence variants or mutants in the presence of an
excess of closely related DNA sequences.
increase the selectivity of amplification. For example, where
a sequence difference corresponds to a restriction enzyme site,
restriction enzyme digests can be used to cut an unwanted
sequence and prevent its amplification. Another method
of suppressing amplification is the use of oligonucleotides
or peptide nucleic acid (PNA) molecules that anneal to one
of the DNA strands, within the region to be amplified and/or
overlapping the binding site of one of the primers; thus, preventing initiation or elongation of DNA synthesis (1–4). Such
oligonucleotides are designed to preferentially anneal with
and suppress amplification of one of two related sequences.
This method has recently been applied to the selective amplification of methylated DNA sequences after treatment with
bisulphite (5).
We describe below a novel method termed Headloop PCR
for selectively suppressing the amplification of one or more
closely related sequences while using PCR primers that can
prime and extend on both the target and the suppressed
sequences. In this method, amplification of selected sequences
is prevented through a 50 extension on one (or both) of the
primers. After the 50 extension is incorporated into the PCR
product by being copied by polymerase, the new region
(‘head’) has the potential of causing internal priming by
looping back and hybridizing to an internal region of
the unwanted product. The internal priming causes the production of a hairpin loop structure that is a poor substrate for
further amplification, limiting amplification of the unwanted
species.
Headloop PCR is well suited to situations in which the
desired target for amplification is present as a rare sequence
in a large excess of a closely related sequence. We have
applied this technology for the selective amplification of
methylated DNA sequences from bisulphite-treated DNA.
Following bisulphite treatment, cytosines are converted to
uracil and then to thymine during PCR, while methylated
cytosines, predominantly present at CpG sites in mammalian
DNA, are refractory to conversion and remain as cytosines
following PCR (6). By designing Headloop primers that cause
e127
Nucleic Acids Research, 2005, Vol. 33, No. 14
looping back and extension on sequences derived from DNA
not methylated at CpG sites it is possible to selectively
suppress amplification of unmethylated sequences. Although
emphasis here is on use in the methylation field, utility is not
limited to this area and we show an example of how it can be
used to improve specificity of the 16S rRNA gene detection of
bacterial species.
MATERIALS AND METHODS
DNAs, oligonucleotide primers and probes
OF
11
bisulphite-converted DNA: TET-TTGTGTATATTTTGTTGTGGTTTTTTTTTTGTTG-TAMRA, where TET ¼ tetrachlorofluorescein).
For the GSTP1 intragenic region (top strand) Headloop
primers HLint5-10 or HLint5-10Ni were used in conjunction
with the forward primer F52A. PCRs were performed using
plasmid clones of methylated and unmethylated top strand
sequences as for the promoter region above. For the GSTP1
intragenic region (bottom strand) Headloop primer Hlint510B1 was used in conjunction with reverse primer GSTBintR2
and Taqman probe GSTBMC3, 50 -VIC-TCGCCGCCGCAAT-mgbnfg.
For 16S ribosomal RNA genes DNA isolated from
Escherichia coli, Sulfobacillus acidophilus and Sulfobacillus
thermosulfidooxidans was used in PCR (kindly provided by
Dr Chun Liu). The reverse primer NR-R1 was used with the
forward primers NR-F1i or NR-F1i with Headloop extensions
SAHL, EHL48 or EHL2a. The amplicon covers the region
starting at base 9609 of the E.coli 16S rRNA gene (GenBank
accession no. AE000452).
Headloop PCRs
Real-time PCR was carried out using an ABI PRISM 7700
Sequence Detection System. Standard conditions for hot start
PCR (in 25 ml) were 1· platinum Taq buffer [20 mM Tris–HCl
(pH 8.4) and 50 mM KCl], 1.5 mM MgCl2, 0.2 mM of each
dNTP, 200 nM primers and 0.75 U platinum Taq DNA polymerase from Invitrogen. Taqman probes were used at 50 nM
(PRBM) or 100 nM (PBRU).
For the GSTP1 promoter Headloop PCR, cycling conditions
were as follows: 95 C for 120 s, then 50 cycles at 95 C for 15 s,
60 C for 60 s. For GSTP1 intragenic (top strand) PCR cycling
conditions were as follows: 95 C for 120 s, then 50 cycles at
95 C for 15 s, 60 C for 60 s. For GSTP1 intragenic (bottom
strand) PCR cycling conditions were as follows: 95 C for
Table 1. Primers
Target
GST promoter
F2
LUHF2
CLURF2
R1T
GST intragenic
HLint5-10
HLint5-10Ni
F52A
GST intragenic bottom strand
HLBint5-10
BintR2i
MSP Intragenic
Msp102
Msp104
16S rRNA
NR-F1i
SAHL
EHL2a
EHL48
NR-R1
Head sequence: 50 –30
Priming sequence: 50 –30
aCaCCaaaACATCaCaaaa
CCATCAACAAAAAACACACA
GGTTtTAGGGAATTTttttt
GGTTtTAGGGAATTTttttt
GGTTtTAGGGAATTTttttt
CACCTTTCCCAaaTCCCCAa
tGtGtGGTTtGtGTTTtG
tGtGtGGTTtGtGTTTtG
CCCCATaCTaaaAaCTCTaAaCCCCAT
CTCTaAaCCCCATCCCCIaaa
GGGAttAtttTTATAAGGtTAGGAGGt
aCaCaACCCaCaTCCCCaAA
TGtTGGGAGtTtTGAGtttATttt
aAaaCCICIAaaCCTTCICTaaAaTTTC
CGtAGTtTTCGttAttAGTGAGTACGC
GAaaTaaaCGAaaAaCCCTaCCGa
CGACACCTCGTATCCAT
ACAACCTCCAAGTCGACAT
GACTTAACGCGTTAGCTC
GTAGTCCIIGCIITAAACGAT
GTAGTCCIIGCIITAAACGAT
GTAGTCCIIGCIITAAACGAT
GTAGTCCIIGCIITAAACGAT
GACTTAACGCGTTAGCTC
For all primers a lower case t or a corresponds to a U or T that results from the bisulphite conversion of a C in the original DNA, while boldface bases correspond to the
positions of Cs at CpG sites. The underlined A in F52A is a mismatch corresponding to the T or C expected at CpG-4. I stands for inosine, introduced as a mismatch at
some CpG sites in primers for bisulphite-treated DNA or at variable positions in the 16S rRNA genes.
Downloaded from http://nar.oxfordjournals.org/ by guest on September 6, 2014
The sequences of primers are shown in Table 1; cartridge
purified oligonucleotides were purchased from Sigma. Fully
CpG-methylated genomic DNA (Chemicon) or white blood
cell DNA (Roche Diagnostics) were treated with sodium
bisulphite as described previously (7). For the GSTP1 promoter region a pair of plasmids (plasmids U and M) containing
inserts derived from bisulphite treatment and PCR amplification of the region between positions 854 and 1297 (GenBank
accession no. M24485) were used as substrates for PCR.
In Plasmid U, representing unmethylated DNA, all Cs in
the original sequence had been converted to Ts. In plasmid
M, representing methylated DNA, all Cs except those at CpG
positions that correspond to methylated Cs had been converted
to T. PCR amplification of the M + U plasmid mixture was
performed with the base primer F2, or the Headloop primer
LUH F2 or the control primer CLUR F2 in conjunction with
the reverse primer R1T. Note that this primer has a short tail
to provide a higher annealing temperature after initial
incorporation—this is not relevant to the Headloop mechanism. Taqman probes for the promoter region were as follows:
PBRM (specific for methylated bisulphite-converted DNA:
FAM-TTGCGTATATTTCGTTGCGGTTTTTTTTT-TAMRA,
where FAM ¼ carboxyfluorescein and TAMRA ¼ carboxytetramethylrhodamine) and PBRU (specific for unmethylated
PAGE 2
PAGE 3
OF
11
120 s, 5 cycles (95 C for 15 s, 60 C for 60 s), then 60 cycles
(88 C for 15 s, 60 C for 60 s).
For 16S rRNA PCR cycling conditions were as follows:
95 C for 60 s, then 40 cycles at 95 C for 30 s, 58 C for 30 s
and 72 C for 30 s.
When SYBR Green was included either during the reaction
or added subsequently for melting curve analysis, it was added
at 1/125 000 dilution of the solution obtained from Molecular
Probes, Inc. Variations in reaction conditions are indicated in
the text.
Methylation-specific PCR
RESULTS
Principle of Headloop PCR
The mechanism of action of Headloop PCR is outlined in
Figure 1. The two sequences A and B are closely related,
but differ in the boxed regions. The reverse primer R matches
Figure 1. Principle of Headloop suppression PCR.
e127
both sequences exactly, as does the black arrow region of the
forward primer, F. The Headloop primer is shown as the forward primer—it comprises a standard forward PCR primer
with homology to the target sequences to be amplified with
a 50 extension (coloured red) that is complementary to a region
within Sequence A. When the reverse primer is extended on the
product of first round synthesis with the forward primer, this
extension is incorporated into the second strand product. After
denaturation the incorporated 30 tail extension is able to loop
back and anneal to its complementary region, and be extended
to form a hairpin structure. Since intramolecular annealing is
known to be very rapid this is expected to re-anneal after denaturation and no longer provide a template for further amplification. However, in the case of Sequence B, mismatch(es) to the
equivalent region limit self-priming to form a hairpin and the
DNA is able to undergo further amplification with the forward
and reverse primers. If the forward primer is chosen as the base
for a Headloop primer, the sequence of the 50 extension on the
primer is the reverse complement of the target top strand
sequence. If the Headloop primer is based on the reverse primer
the extension will comprise the sequence of the target region as
directly read from the top strand.
We have applied the principle of Headloop suppression
PCR for selective amplification of methylated DNA sequences
following bisulphite conversion of DNA. Treatment with
sodium bisulphite converts cytosines to uracils (thymines
after PCR). Methylated cytosines are unreactive, however,
and remain as cytosines following the bisulphite reaction
Downloaded from http://nar.oxfordjournals.org/ by guest on September 6, 2014
Methylation-specific PCR (MSP) of the GSTP1 intragenic
region was carried out using primers Msp102 and Msp104
(Table 1) and fluorescent probe PRBCS3, 50 -VIC-CCCATACTAAAAACTCAAACCCCATCCC-TAMRA, specific for
bisulphite-converted DNA. After initial denaturation at 95 C
for 120 s. cycling conditions were as follows: 5 cycles (95 C
for 15 s, 65 C for 60 s), then 50 cycles (87 C for 15 s, 65 C
for 60 s).
Nucleic Acids Research, 2005, Vol. 33, No. 14
e127
Nucleic Acids Research, 2005, Vol. 33, No. 14
and subsequent PCR. Thus, the treatment of two DNA
sequences that are identical except that one is methylated at
specific cytosines while the other is not, leads to molecules that
are identical except for the presence of Cs rather than Us at the
specific sites that were methylated in the original DNA. It is
therefore possible to design the head region of the primer to
selectively suppress amplification of sequences derived from
unmethylated DNA; thus, allowing the detectable amplification of low amounts of methylated DNA that would otherwise
have been out competed. Application to selective amplification of methylated sequences of the GSTP1 promoter is shown
below.
Selective amplification of methylated GSTP1 sequences
The human GSTP1 gene promoter is commonly methylated
at CpG sites in prostate cancer (8) and genomic sequencing
PAGE 4
OF
11
has indicated extensive methylation across the promoter and
intragenic regions (9,10). We have previously cloned from
bisulphite-treated DNA GSTP1 promoter sequences corresponding to DNA that was originally either fully methylated
at all CpG sites from CpG sites 41 to +10 or fully unmethylated. A Headloop PCR was developed to selectively amplify
methylated DNA sequences from within this region.
The base primers F2 and R1T are specific for amplification
of bisulphite-treated DNA from the GSTP1 promoter region
(both cover regions where there are a number of Cs, including
those corresponding to the terminal, priming bases) but have
no selectivity for differential priming on methylated or
unmethylated DNA. A Headloop extension, 50 -aCaCCaaaACATCaCaaaa to the forward primer F2 was designed so that
after its incorporation into the PCR product it would loop back,
anneal to the target region of the unmethylated DNA as indicated in Figure 2 (primer LUH F2), priming to form an extended
Downloaded from http://nar.oxfordjournals.org/ by guest on September 6, 2014
Figure 2. Target regions for Headloop PCR on GSTP1 gene. Sequences are shown for the promoter region of the GSTP1 gene (A) and the intragenic region, top strand
(B) or bottom strand (C). For each the unmodified sequence is shown (W) and below it the expected sequences after bisulphite treatment if the DNA were methylated
(M) or unmethylated (U). Numbering of CpG sites relative to the transcription start site is shown above the sequences. Primer regions are boxed and shaded yellow.
Head regions are boxed and shaded blue. T residues resulting from conversion of a C are shown as lower case (t); I ¼ inosine. Cs or Ts at the position of CpG sites and
the discriminatory A bases in the head sequence are highlighted in red.
PAGE 5
OF
11
hairpin molecule. The target region includes five CpG
sites, with the underlined base corresponding to CpG site
34 defining the 30 priming base for Headloop extension to
form a hairpin structure. The primer CLUR is a control
primer in which the Headloop extension sequence has been
jumbled.
Suppression of amplification of unmethylated sequences
was tested by performing real-time PCR with separate probes
for the detection of methylated and unmethylated sequences
on plasmid mixtures containing 107 unmethylated molecules
and 103 methylated molecules. In the absence of the Headloop
extension, or with a control randomized extension, amplification yields only unmethylated PCR products (Figure 3). Presence of the Headloop (primer LUH F2) allows efficient
amplification of methylated sequences, with essentially
Nucleic Acids Research, 2005, Vol. 33, No. 14
e127
complete suppression of amplification of unmethylated
sequences that are present in 104-fold excess.
Factors affecting Headloop PCR efficiency
We have evaluated a number of reaction parameters in order to
identify those important in allowing selective amplification.
Among factors evaluated, the level of free Mg2+ ions was
particularly critical. The effect of varying the concentration
of Mg2+ ions is shown in Figure 4 using two Headloop primers
targeted to sequences just downstream from the GSTP1 transcription start site (Figure 4). Amplifications using either
HLint5-10Ni or HLint5-10 were carried out in the presence
of 1.1, 1.3 or 1.5 mM MgCl2. The proportion of methylated
and unmethylated amplicons in the final product was estimated
Figure 4. Effect of magnesium ion concentration on Headloop PCR. Headloop PCR on the intragenic region of the GSTP1 gene was performed in a mixture of
methylated (103 copies) and unmethylated (107 copies) plasmids using either the Hlint5-10 or the Hlint5-10Ni primer under standard conditions except that the
concentration of MgCl2 was varied as shown. Denaturation profiles of the amplification products are shown. The lower Tm peak, 79–80 C, corresponds to the
unmethylated amplicon and that at 83–84 C to the methylated amplicon (verified previously using individual plasmids).
Downloaded from http://nar.oxfordjournals.org/ by guest on September 6, 2014
Figure 3. Selective amplification of methylated GSTP1 promoter sequences. PCR amplification was done on a mixture of methylated (103 copies) and unmethylated
(107 copies) DNA using base primer F2 (red line), Headloop primer LUH F2 (green line) or control primer CLUR F2 (blue line). The left panel shows detection with
the probe specific for unmethylated DNA and the right panel the probe for methylated DNA.
e127
Nucleic Acids Research, 2005, Vol. 33, No. 14
OF
11
dependent on the annealing temperature, but will be prevented
or limited if a hairpin structure has already formed. The effect
of annealing temperature on a Headloop PCR is shown in
Figure 5. Also shown are the effects of the addition of betaine,
a reagent that weakens the interaction of G–C base pairs (11).
Mixtures of unmethylated (107) and methylated (103) plasmids
were amplified using the Headloop primer HLint5-10 with
the annealing step performed at a range of temperatures.
The selectivity of the reaction was seen to be dependent on
the annealing temperature, the maximum proportion of
methylated amplicon being produced at 62.5 C for this Headloop PCR. Addition of betaine was seen to substantially
improve the ratio of methylated product at lower annealing
temperatures, but its effect was minimal at higher temperatures. It might also be expected that intramolecular priming
would be favoured by lower concentrations of Headloop
primer and lowering of a Headloop primer concentration to
20–60 nM was shown to enable selective amplification of
Figure 5. Effects of temperature and betaine on Headloop PCR. Headloop PCR on the GSTP1 intragenic region was done under standard conditions using the Hlint510 primer except that the annealing/extension temperature of the reaction was varied as shown. In reactions in the right column, betaine was included at 800 mM.
Denaturation profiles of PCR products are shown.
Downloaded from http://nar.oxfordjournals.org/ by guest on September 6, 2014
from melting curves. In both cases there was a concentrationdependent improvement in selectivity with decreasing levels
of MgCl2. This effect has been seen with a number of different
Headloop primers (data not shown). Equivalent effects are
seen when the concentration of free Mg2+ ions is lowered
by the addition of EDTA or extra nucleotides. Optimal Headloop selectivity is consistently seen at the lowest Mg2+ levels
used that allow PCR amplification of the target sequences.
In most cases this has corresponded to a level of free Mg2+
ions of 0.3 mM.
The selectivity of Headloop PCR depends on competition
between competing intermolecular and intramolecular processes. The rate and extent of intramolecular hybridization
of the head region to its target site and subsequent priming
to form hairpin structures is dependent on the degree of match
with the target sequence and also on the annealing conditions,
including temperature. Intermolecular hybridization of
primer and template leading to PCR amplification is similarly
PAGE 6
PAGE 7
OF
11
methylated DNA when present in a ratio of 1:105 with
unmethylated DNA (Supplementary Figure 1).
Selective amplification from genomic DNA
Amplification of small quantities of methylated gene
sequences from an excess of unmethylated sequences in
genomic DNA is most commonly performed using MSP (12)
or its real-time derivatives, Methylight (13) or ConLight
PCR (14), where specific fluorescent probes are used to detect
the PCR product. Mixtures of genomic DNAs containing
methylated and unmethylated GSTP1 sequences were used
to evaluate the capacity of Headloop PCR to amplify target
sequences from mixed sequence DNA. A Headloop PCR assay
Nucleic Acids Research, 2005, Vol. 33, No. 14
e127
designed to the bottom strand of the GSTP1 gene and using
CpG sites 5–10 for selectivity, was compared with MSP
designed to the same DNA region. The sequence of the
bisulphite-converted bottom strand and primer positions are
shown in Figure 2C. The sensitivity of both assays was
compared using limiting amounts of methylated DNA
(Supplementary Figure 2); both assays showed a similar capacity to detect sequences down to single cell levels and reliable
detection from levels >25 pg (4 cell equivalents). The Headloop PCR amplification profiles on 100 pg of methylated DNA
spiked into 10 ng of white blood cell DNA (in which there is
minimal methylation of GSTP1 gene) is compared with that
from 400 ng of white blood cell DNA in Figure 6A and B.
Downloaded from http://nar.oxfordjournals.org/ by guest on September 6, 2014
Figure 6. Headloop PCR on genomic DNA. Headloop PCR to the intragenic region (bottom strand) of the GSTP1 gene was performed using 400 ng bisulphite-treated
white blood cell DNA (A) or 100 pg of in vitro methylated white blood cell DNA spiked into 10 ng unmethylated DNA (B). (C) Amplification using Headloop PCR
(BHL, triangles) is compared with MSP (circles). Total input DNA was 50 ng in each PCR with the amount of methylated DNA ranging from 100 pg to 50 ng.
Ct values are plotted against % methylated DNA in starting mixture.
e127
Nucleic Acids Research, 2005, Vol. 33, No. 14
PAGE 8
OF
11
Figure 7. Headloop target regions on 16S rRNA. Sequences from the S.thermosulfooxidans and S.acidophilus 16S rRNA genes are shown below that from the E.coli
gene. Dashes indicate identity to the E.coli sequence and ‘D’ deletions. The position of the forward base primer NR-Fli is shown as are the head sequences EHL2a and
EHL48 targeted to suppress E.coli rDNA amplification, and SAHL targeted to suppress amplification of S.acidophilus rDNA. Mismatches to non-target sequences
are shown in boldface.
Selective amplification of bacterial 16S rRNA genes
To demonstrate that its application is not restricted to DNA
methylation analysis, Headloop PCR was applied to the differential amplification of a region of the 16S rRNA genes from
three bacterial species (Figure 7). The base primers we used
were primers NR-R1i and NR-F1i that were designed to wellconserved regions to amplify the corresponding region from a
wide range of bacterial species. Different 50 extensions were
added to the NR-R1i primer. Two of these, EHL48 and EHL2a
were designed for looping back and priming on E.coli derived
sequences. These were used for amplification from a mixture
of 50:1 E.coli to S.thermosulfooxidans DNA (Figure 8). With
both Headloop primers substantial selective amplification of
S.thermosulfooxidans DNA was seen compared to the control
non-Headloop primer. The EHL2a Headloop that targets a
region immediately adjacent and overlapping the forward
primer showed >50-fold enrichment, while EHL48 showed
significant but lower enrichment. The EHL48 Headloop target
is further away from the primer and has less mismatches with
the S.thermosulfooxidans sequence.
A Headloop primer at the equivalent position to the EHL2a
primer, but targeted to suppress amplification of the 16S rRNA
amplicon from S.acidophilus was also designed and evaluated
for its capacity to allow selective amplification of E.coli DNA.
Under standard PCR conditions, with MgCl2 at 1.5 mM an
50-fold enrichment of E.coli sequences was seen. Lowering
the MgCl2 concentration to 1.3 mM caused a significant
improvement in selectivity and E.coli sequences could clearly
be detected when a 250-fold excess of S.acidophilus DNA was
present in the starting mix.
DISCUSSION
We have developed a new, sensitive technology that allows the
amplification of trace amounts of methylated DNA from
bisulphite-treated DNA in the presence of a large excess of
unmethylated DNA. Selectivity of at least 104-fold has been
obtained with a number of Headloop primers targeted to
different sequences. Headloop PCR uses three sequence
regions to determine the final specificity of amplification.
Even greater selectivity can potentially be achieved by incorporating heads on both forward and reverse primers and we
have shown that this can work in one instance (data not
shown). The two priming sites are used to provide selective
amplification of the target gene from bisulphite-treated DNA,
with a key criterion to their design being that they are selective
for DNA that has been efficiently converted by bisulphite—
annealing and extension should be dependent on T (or U) bases
that have arisen through bisulphite conversion of Cs. The head
is targeted to a region of differential methylation of CpG sites
within the amplicon so that after incorporation into the PCR
product it can fold back, anneal and prime to form a hairpin
structure. In its application to bisulphite-treated DNA we have
introduced ‘heads’ onto either the forward or reverse primer
thus having either As or Ts, respectively, as the bases imparting selectivity in suppression of amplification. Difficulties in
PCR caused by internal priming of short inverted repeats
yielding inhibitory hairpin structures have been described
previously (13) and in Headloop PCR this feature is used to
provide a specific, selective suppression. We expect that the
hairpin molecules formed are amplified very poorly because
they will snap back rapidly after the denaturation step, thus
preventing access of primers. Cloning of ‘suppressed’ PCR
products indeed has indicated that hairpin structures were
formed. Sequenced clones were truncated as though the loop
had been cut off and only the anticipated double-strand region
of the molecule maintained. We assume such products arose
from nuclease action in the bacteria to remove the loop allowing ligation of the second end to the plasmid vector.
Comparison with other approaches to selective
amplification of methylated DNA
Currently the most widely used technique for amplifying
methylated DNA sequences from a large excess of unmethylated sequences is MSP (12) and real-time methods based on
the same primer design principle (13,14), while an approach
using blocking oligonucleotides, HeavyMethyl PCR, has been
published more recently (5). We have demonstrated selectivity
of Headloop PCR of 1:104 to 1:105 in a number of assays and
its performance compares favourably with MSP [Figure 6,
Supplementary Figure 3 and up to 1:105, (13)] and with
HeavyMethyl PCR [up to 1:8000 with genomic DNA, (5)].
In MSP the amplifying primers are targeted to include a
number of CpG sites, particularly toward the 30 end priming
site in order to take advantage of the sequence differences after
bisulphite conversion of DNAs methylated or unmethylated at
specific CpG sites. While MSP is widely used and can allow
very sensitive detection of methylated molecules, there can be
Downloaded from http://nar.oxfordjournals.org/ by guest on September 6, 2014
A concentration range of 0.2–100% methylated DNA (in a
total of 50 ng DNA) was used to compare selective amplification by Headloop PCR with that of MSP (Figure 6C). The data
show the potential of Headloop PCR to be used to quantify
levels of methylated DNA. In a separate experiment both of
these assays and the Headloop assay to the top strand of the
intragenic region were shown to detect the methylated GSTP1
gene in 100 pg of methylated DNA mixed with 400 ng of
unmethylated DNA in 8 of 8 replicates, equivalent to detection
of methylated DNA from
