Establishing secure connection… Loading editor… Preparing document…
Navigation

Fill and Sign the Jiit Medical Certificate Form

Fill and Sign the Jiit Medical Certificate Form

How it works

Open the document and fill out all its fields.
Apply your legally-binding eSignature.
Save and invite other recipients to sign it.

Rate template

4.7
38 votes
RESEARCH ARTICLE 5257 Development 138, 5257-5267 (2011) doi:10.1242/dev.069062 © 2011. Published by The Company of Biologists Ltd A conserved PTEN/FOXO pathway regulates neuronal morphology during C. elegans development Ryan Christensen1, Luis de la Torre-Ubieta2, Azad Bonni2 and Daniel A. Colón-Ramos1,* SUMMARY The phosphatidylinositol 3-kinase (PI3K) signaling pathway is a conserved signal transduction cascade that is fundamental for the correct development of the nervous system. The major negative regulator of PI3K signaling is the lipid phosphatase DAF-18/PTEN, which can modulate PI3K pathway activity during neurodevelopment. Here, we identify a novel role for DAF-18 in promoting neurite outgrowth during development in Caenorhabditis elegans. We find that DAF-18 modulates the PI3K signaling pathway to activate DAF-16/FOXO and promote developmental neurite outgrowth. This activity of DAF-16 in promoting outgrowth is isoform-specific, being effected by the daf-16b isoform but not the daf-16a or daf-16d/f isoform. We also demonstrate that the capacity of DAF-16/FOXO in regulating neuron morphology is conserved in mammalian neurons. These data provide a novel mechanism by which the conserved PI3K signaling pathway regulates neuronal cell morphology during development through FOXO. INTRODUCTION The phosphatidylinositol 3-kinase (PI3K) signaling pathway is a conserved signal transduction cascade that is essential for proper nervous system development (Cosker and Eickholt, 2007; Eickholt et al., 2007; Shi et al., 2003; van der Heide et al., 2006; Waite and Eickholt, 2010). Activation of the PI3K signaling pathway relies on activation of class I PI3-kinase, which generates signaling intermediate molecule PIP3 (phosphatidylinositol 3,4,5trisphosphate) (Vanhaesebroeck et al., 2001). PIP3 mediates the recruitment and activation of kinases, adaptor proteins and small GTPases to regulate neurodevelopmental responses ranging from cell survival to synaptic development. The dual specificity phosphatase PTEN dephosphorylates PIP3 to antagonize the PI3K signaling pathway (Li et al., 1997; Maehama and Dixon, 1998). PTEN is highly expressed in the nervous systems of animals, and regulation of PI3K signaling by PTEN is crucial for neurodevelopment (Gimm et al., 2000; Lachyankar et al., 2000; Masse et al., 2005). In Caenorhabditis elegans, the PI3K/PTEN pathway regulates neuronal polarization prior to axon outgrowth (Adler et al., 2006). The PI3K/PTEN pathway regulates cell size, branching and polarization in cultured neuronal cells (Higuchi et al., 2003; Jia et al., 2010; Lachyankar et al., 2000; Musatov et al., 2004). Pten deletion in mouse neurons results in neuronal hypertrophy, ectopic axon formation and excessive branching (Backman et al., 2001; Fraser et al., 2004; Kwon et al., 2006; Kwon et al., 2001; van Diepen and Eickholt, 1 Program in Cellular Neuroscience, Neurodegeneration and Repair, Department of Cell Biology, Yale University School of Medicine, P.O. Box 9812, New Haven, CT 06536-0812, USA. 2Department of Neurobiology, Harvard Medical School, New Research Building, Room 856, 77 Ave. Louis Pasteur, Boston, MA 02115, USA. *Author for correspondence (daniel.colon-ramos@yale.edu) This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Share Alike License (http://creativecommons.org/licenses/by-nc-sa/3.0), which permits unrestricted non-commercial use, distribution and reproduction in any medium provided that the original work is properly cited and all further distributions of the work or adaptation are subject to the same Creative Commons License terms. Accepted 7 October 2011 2008). Inactivating mutations of PTEN in humans result in neurological defects such as mental retardation, ataxia and seizures (Arch et al., 1997; Liaw et al., 1997; Marsh et al., 1997). Therefore, PTEN plays a conserved role in regulating the development and wiring of the nervous system. The PI3K/PTEN pathway relies primarily on the modulation of cytoskeletal dynamics and mTOR-dependent protein synthesis to instruct neuronal morphogenesis (Cosker and Eickholt, 2007; van Diepen and Eickholt, 2008). The increase in neuronal cell size observed in Pten-null neurons can be reversed by treatment with an mTOR inhibitor (Kwon et al., 2003; Zhou et al., 2009), suggesting that the effects of Pten deletion on neurodevelopment are mediated primarily through PI3K-derived mTOR activation and protein synthesis. Interestingly, in neuron-specific Pten knockout mice, granule cells of the dentate gyrus show a loss of neuronal polarity even after rapamycin treatment, suggesting mTORindependent pathways could also be involved in PTEN-mediated neurodevelopment (Zhou et al., 2009). The identity of these mTOR-independent pathways is currently unknown. Here, we identify a novel pathway by which PTEN regulates neuronal morphology and outgrowth during development. We first report a novel role for DAF-18/PTEN in promoting neurite outgrowth during development in C. elegans. This novel function adds to PTEN’s known role in inhibiting axon outgrowth through mTOR-dependent pathways (Kwon et al., 2003; Zhou et al., 2009). We find that DAF-18 promotes axon outgrowth in C. elegans through an mTOR-independent pathway. Our data indicate that DAF-18 modulates the PI3K signaling pathway to activate DAF16/FOXO and promote developmental axon outgrowth. Importantly, we show that this novel role of DAF-16 in developmental outgrowth is mediated by a specific isoform, DAF16B. We also demonstrate that this outgrowth-promoting role of DAF-16/FOXO is conserved in mammalian neurons. MATERIALS AND METHODS Strains and genetics Worms were raised at room temperature using OP50 Escherichia coli seeded on NGM plates. Strains with a pdk-1(sa680) or daf-2(e1370) mutation were raised at a permissive temperature of 16°C and analyzed at DEVELOPMENT KEY WORDS: FOXO, PTEN, Axon outgrowth, Dendrite morphology, Neurodevelopment 5258 RESEARCH ARTICLE Development 138 (23) 22°C or 25°C, respectively. To control for maternal rescue in the first generation, age-1(mg44) and daf-18(mg198); age-1(mg44) mutants were analyzed as second-generation age-1(mg44) homozygotes. N2 Bristol was utilized as the wild-type reference strain. Strains obtained through the Caenorhabditis Genetics Center include: GR1032 age-1(mg44) II/mnC1 dpy-10(e128) unc-52(e444) II, VC204 akt-2(ok393) X, GR1308 daf16(mg54) I; daf-2(e1370) III, JT9609 pdk-1(sa680) X, KR344 let-363(h98) dpy-5(e61) unc-13(e450) I; sDp2(I;f), HT1881 daf-16(mgDF50) I; daf2(e1370) unc-119(ed3) III; lpIS12, HT1882 daf-16(mgDF50) I; daf2(e1370) unc-119(ed3) III; lpIS13, HT1883 daf-16(mgDF50) I; daf2(e1370) unc-119(ed3) III; lpIS14, KQ1366 rict-1(ft7) II, CF1038 daf16(mu86) I, VC1027 daf-15(ok1412)/nT1 IV; +/nT1 V, CB1370 daf2(e1370) III. SO26 daf-18(mg198) IV was provided by the Solari laboratory, Centre Leon Berard, Leon, France. GR1309 daf-16(mgDF47) I; daf-2(e1370) III was provided by the Ruvkun laboratory, Boston, MA, USA. OH99 mgIS18 IV and LE311 lqIS4 X were provided by the Hobert laboratory, New York, NY, USA. FX00399 akt-1(tm399) V was provided by the Japanese Knockout Consortium, Tokyo, Japan. (Zone 2 and Zone 3) using a 60⫻ CFI Plan Apo VC, NA 1.4, oil objective on an UltraView VoX spinning disc confocal microscope (PerkinElmer). Zone 2 and Zone 3 were defined as the portion of the AIY neurite that turned and extended dorsally, respectively. These regions were measured in 3D by using Volocity software (Improvision). Statistical significance was calculated using Student’s t-test or Fisher’s Exact Test. Molecular biology and transgenic lines Morphological analysis of cerebellar granule neurons Expression clones were made in the pSM vector, a derivative of pPD49.26 (A. Fire, Stanford University School of Medicine, Stanford, CA, USA) with extra cloning sites (S. McCarroll and C. I. Bargmann, unpublished data). The plasmids and transgenic strains (0.5-30 ng/l) were generated using standard techniques and co-injected with markers Punc-122::gfp or Punc122::dsRed (15- 30 ng/l): wyIs45 [Pttx3::gfp::rab3], wyIs92 [Pmig-13::snb-1::yfp+odr1::rfp], olaEx20 [Pttx3::mch, Pglr3::mch, Pdaf-18::daf-18 cDNA, Punc122::GFP], olaEx25 [Pttx3::mch, Pglr3::mch, Pdaf-18::daf-18 cDNA, Punc122::GFP], olaEx72 [Pttx-3b::daf-18 cDNA, punc-122::GFP], olaEx73 [Pttx-3b::daf-18 cDNA, Punc-122::GFP], olaEx528 [Pttx-3b::GFP, Punc122::GFP], olaEx529 [Pttx-3b::GFP, Punc-122::GFP], olaEx531 [Pttx3b::GFP, Punc-122::GFP], olaEx532 [Pttx-3b::GFP, Punc-122::GFP], olaEx533 [Pttx-3b::GFP, Punc-122::GFP], olaEx534 [Pttx3g::HRP::CD2::GFP, Punc-122::GFP], olaEx760 [Pttx-3g::GFP, Punc122::GFP], olaEx761 [Pttx-3g::GFP, Punc-122::GFP], olaEx762 [Pttx3g::GFP, Punc-122::GFP], olaEx763 [Pttx-3g::mCH, Pdaf-16b::GFP], olaEx764 [Pttx3::mch, Pglr3::mch, cosmid R13H8, Punc-122::GFP]. Fluorescence microscopy and confocal imaging Images of fluorescently tagged fusion proteins were captured in live C. elegans using a 60⫻ CFI Plan Apo VC, NA 1.4, oil objective on an UltraView VoX spinning disc confocal microscope (PerkinElmer). Worms were immobilized using 50 nM levamisole (Sigma), oriented anterior to the left and dorsal up. Mosaic analysis Mosaic analysis was conducted on daf-18(mg198) or daf-16(mgDF47) animals as described previously by expressing unstable transgenes with the rescuing pdaf-18::daf-18 cDNA (Solari et al., 2005) or cosmid R13H8 (for daf-16 mosaics), and cytoplasmic cell-specific markers in RIA and AIY (Colon-Ramos et al., 2007; Yochem and Herman, 2003). Animals were inspected for retention of the transgene and rescue using a Leica DM5000 B microscope. Transfection and immunocytochemistry Primary cerebellar granule neurons were prepared from P6 Long Evans rat pups as described (Konishi et al., 2002). One day after culture preparation, neurons were treated with cytosine arabinofuranoside (AraC) at a final concentration of 10 M to prevent glial proliferation. Granule neurons were transfected using a modified calcium phosphate method as described (de la Torre-Ubieta et al., 2010). Cells were fixed at the indicated time points and subjected to immunocytochemistry with the GFP (Molecular Probes) antibody together with the MAP2 (Sigma) or Tau1 (Chemicon) antibodies, and stained with the DNA-binding dye bisbenzimide (Hoechst 33258). To characterize the morphology of cerebellar granule neurons, individual images were captured randomly and in a blinded manner on a Nikon eclipse TE2000 epifluorescence microscope using a digital CCD camera (Diagnostic Instruments). Images were imported into Spot Imaging Software (Diagnostic Instruments) and the length of neuronal processes was analyzed by tracing. Total length is the length of processes including all its branches added together for a given neuron. To analyze neuron polarization, neurons were scored in a blinded manner as polarized or nonpolarized as previously described (de la Torre-Ubieta et al., 2010; Shi et al., 2003). A neuron in which the longest neurite was at least twice as long as the other neurites was considered to be polarized. Data were collected from three independent experiments with 50-100 neurons scored per condition per experiment. RNAi and rescue constructs A DNA template-based method of RNAi was used to express short hairpin RNAs (shRNAs) targeting the sequence GAGCGTGCCCTACTTCAAGG in FOXO1, FOXO3 and FOXO6 (de la Torre-Ubieta et al., 2010). Sequences for the scrambled shRNAs are TACGCGCATAAGATTAGGGTG (U6/scr1) and AAGTGCCAATTTCGATGATAT (U6/scr2). The rescue construct for FOXO6 (FOXO6-Res) was generated by engineering silent mutations (indicated by bold font) on FOXO6 as follows: CGTCCCGTATTTCAAGG (de la Torre-Ubieta et al., 2010). Statistics Statistical analyses were performed using GraphPad software. In experiments in which only two groups were analyzed, comparison of the two groups was carried out using Student’s t-test. Pairwise comparison within multiple groups was carried out by analysis of variance (ANOVA) followed by the Bonferroni post-hoc test. All histogram data were obtained from three or more independent experiments and are presented as mean ± s.e.m. unless otherwise specified. Statistical information and the total number of cells analyzed per experiment are provided in the figure legends. Quantification of AIY outgrowth in wild-type and mutant animals was carried out on a Leica DM5000 B microscope. Neurite truncations were scored as a failure of the two AIY neurites to meet at the dorsal midline. Neurite outgrowth in embryos was quantified by measuring the length of the whole neurite and Zone 3 (dorsal portion of the neurite) regions in confocal micrographs using Volocity 5 software (Improvision). Zone 3 length was averaged using images of several embryos (three to six) taken at each developmental time point, with individual Zone 3 lengths determined as described above. Embryos were assigned a stage based on morphological characteristics and developmental time points, such as the beginning of twitching. Quantification of AIY neurite length in wild-type, daf-18(mg198), daf16(mgDF47); and daf-16(mgDF47); daf-18(mg198) L4 animals was carried out by imaging the length of the dorsal portion of both AIY axons RESULTS DAF-18 is required for neurite length The AIY interneurons are a pair of interneurons that modulate temperature response in the nematode (Mori and Ohshima, 1995; White et al., 1986) (Fig. 1A). These neurons are embedded in the nerve ring and show great specificity at the level of morphological development and synaptic partner connectivity (Altun-Gultekin et al., 2001; White et al., 1986). In wild-type animals, the morphology of AIY is exquisitely stereotyped across individual animals (n>500 animals). This facilitates genetic analysis and allows examination of molecules required for neurodevelopment in vivo with single-cell resolution (Altun-Gultekin et al., 2001; Colon-Ramos et al., 2007). DEVELOPMENT Quantification PTEN regulates axon morphology RESEARCH ARTICLE 5259 Fig. 1. DAF-18/PTEN acts cell-autonomously to control neurite length in the AIY interneurons. (A)Schematic of wild-type AIY morphology and location in the nematode nerve ring. Asterisk marks location where two AIY interneurons (red) meet at the dorsal midline (White et al., 1986). Bracket denotes portion of AIY neurite truncated in daf-18(mg198) mutants. Adapted with permission from Zeynep Altun (www.wormatlas.org). Green, pharynx; red, AIY interneurons. (B,C)Confocal micrographs of AIY morphology in wild-type (B) and daf-18(mg198) mutant (C) animals, visualized with cytoplasmic GFP expressed cell-specifically in AIY (pttx-3b::GFP). The three-dimensional reconstructions of the micrographs are oriented as the schematic representation in A to show both bilaterally symmetric AIYs. Note the missing dorsal portion of neurites in daf-18(mg198) animal compared with wild type (brackets). Asterisk denotes location of dorsal midline. (D)Percentage of animals with truncated neurites in wild type (n112) and daf-18(mg198) mutants (n145). (E)Cell-specific rescue of the daf-18 phenotype in AIY. Transgenic daf-18(mg198) mutant animals expressing a daf-18 cDNA rescue construct (pttx-3g::daf-18 cDNA) cell-specifically in AIY were created and the percentage of animals with neurite truncations were quantified. Shown here are the results from two independently generated transgenic lines. As a control we also show the quantification of siblings not carrying the rescuing array. Note how cell-specific expression of daf-18 cDNA in AIY effectively rescued the neurite length defect seen in daf-18(mg198) mutants. ***P40 animals for each examined allele). We then examined whether DAF-18, the primary negative regulator of PI3K signaling, was required for AIY neurodevelopment. We examined the putative null allele daf18(mg198) and observed a highly penetrant AIY neurite length 5260 RESEARCH ARTICLE Development 138 (23) Fig. 2. DAF-18 is required for embryonic neurite outgrowth in AIY. (A)Quantification of the percentage of animals with neurite truncations in wild-type and daf-18(mg198) larval stage 1 (L1) and larval stage 4 (L4) worms. Note that neurite truncations are already present in daf-18(mg198) L1 animals, suggesting that DAF-18 activity is required prior to L1 stage (embryogenesis). (B)Average length of the dorsal portion of the AIY neurite in wild-type and daf-18(mg198) embryos. Blue, wild type; red, daf-18(mg198). AIY was visualized with cytoplasmic GFP expressed under control of the ceh-10 and ttx-3 promoters (Altun-Gultekin et al., 2001; Hobert et al., 1997; Wenick and Hobert, 2004). Average length was calculated from multiple embryos (n>3) at the specified developmental stage. (C)Transmitted light images and confocal micrographs of comma stage embryos (~445 minutes post-fertilization), early 1.5-fold embryos (~465 minutes postfertilization), mid 1.5-fold embryos (~475 minutes post-fertilization) and early 2-fold embryos (~500 minutes post-fertilization) for wild-type and daf-18(mg198) animals. AIY was visualized using a combinatorial promoter system (mgIS18 pttx-3b::GFP and lqIS4 pceh-10::GFP). AIY is highlighted with a white dotted line in all images. Note the overall slower rate of neurite elongation in the daf-18(mg198) embryos compared with wild-type embryos. Error bars represent s.e.m. Scale bars: 2.5m. analyzed daf-18(mg198) mosaic animals retaining the rescuing array in a subset of cells. We observed that mosaic animals retaining the array in AIY were rescued, whereas animals that did not retain the array in AIY, but retained it in other cells, such as postsynaptic partner RIA, were not rescued for the neurite length phenotype in AIY (P

Valuable assistance on finalizing your ‘Jiit Medical Certificate’ digitally

Are you fatigued from the inconvenience of handling paperwork? Search no further than airSlate SignNow, the leading eSignature platform for individuals and organizations. Bid farewell to the lengthy procedure of printing and scanning files. With airSlate SignNow, you can effortlessly complete and endorse documents online. Take advantage of the extensive features integrated into this user-friendly and cost-effective platform and transform your document management strategies. Whether you need to authorize forms or collect signatures, airSlate SignNow manages it all effortlessly, with just a few clicks.

Adhere to this comprehensive guide:

  1. Sign in to your account or sign up for a free trial with our service.
  2. Click +Create to upload a file from your device, cloud storage, or our template collection.
  3. Access your ‘Jiit Medical Certificate’ in the editor.
  4. Click Me (Fill Out Now) to prepare the document on your end.
  5. Add and allocate fillable fields for others (if necessary).
  6. Proceed with the Send Invite setups to solicit eSignatures from others.
  7. Download, print your version, or convert it into a reusable template.

Don’t fret if you need to work with others on your Jiit Medical Certificate or send it for notarization—our solution provides everything necessary to achieve such objectives. Register with airSlate SignNow today and elevate your document management to a new height!

Here is a list of the most common customer questions. If you can’t find an answer to your question, please don’t hesitate to reach out to us.

Need help? Contact Support
Sign up and try Jiit medical certificate form
  • Close deals faster
  • Improve productivity
  • Delight customers
  • Increase revenue
  • Save time & money
  • Reduce payment cycles